Human and Race Post

1. Select only ONE of the following environmental stresses: (a) heat, (b) high levels of solar

radiation, (c) cold, or (d) high altitude. Discuss specifically how this environmental stress

negatively impacts the survival of humans by disturbing homeostasis. (5 pts)

The environmental stress I chose was High levels of solar radiation which has a negative impact on Humans by affecting and disturbing homeostasis. UVA (Ultraviolet Radiation) affects homeostasis because it has the power to penetrate the human’s outer layer of skin which is called the epidermis all the way to the inner layer called the dermis. The other type of radiation is UVB radiation, but this type of radiation only penetrates the Epidermis. Our body does get some type of positive response in exposer to this type of radiation and that is exposure to UVB waves is it creates Vitamin D. One of the biggest stresses this radiation causes is the on the short term spectrum and that would be Sun burn from too much exposure to the sun. Long term effects would be that over exposure of these UV radiation would be types of skin cancer.

2. Identify 4 ways in which humans have adapted to this stress, choosing one specific adaptation

From each of the different types of adaptations listed above (short term, facultative,

Developmental and cultural). Include images of the adaptations. (5 pts each/ 20 pts total)

Short term= I don’t really think that humans have adapted in a way to high levels of solar radiation, but one could be sweat or flushed skin to let us know that we have been in direct sunlight to long, and once you remove yourself from the situation and environment our bodies will transition back to normal.

Facultative= Over exposure to UVA radiation causes some humans phenotype to change and their epidermis to become darker because of an increased melanin production in the top layer of the skin, we call this tanning. The transition period back to normal is a longer period than the short term responses, and most humans purposely expose themselves to the sun to get this response called tanning.

Developmental=   Developmental changes are found in different types of environments. Through evolution humans who have been in warmer environments have had changed to their DNA making their skin darker like people from Africa. These traits you are born with and will not change over your life time.

Cultural = humans are very unique in creating tools to help deal with these environmental stresses to help us survive. I think I great one to deal with High amounts of exposure to radiation would be the creation of Sunblock which helps protect the skin and minimize the amount of UVA that penetrates the Skin. We also created hats and Gazebos that help create shade so we can increase the amount of time we spend out in the sun.

3. What are the benefits of studying human variation from this perspective across environmental

clines? Can information from explorations like this be useful to help us in any way? Offer one

example of how this information can be used in a productive way. (5 pts)

The studying of human variation from this perspective can be very beneficial. If we can determine how long it takes for the DNA to be changed over generations, we could possibly determine the migratory pattern and get closer to the actual timeframe of our ancestors.  It takes over many years to see change in our DNA to change our Phenotypes of skin color, but if we could determine if the sun exposure is really the cause of change then skin color would not be the factor of naming somebody’s race as I always believed.

4. How would you use race to understand the variation of the adaptations you listed in #2? Explain

why the study of environmental influences on adaptations is a better way to understand human

variation than by the use of race. (10 pts)

The term race is usually dependent upon someone’s skin color, but as I listed above if they studied the human variation to sun exposure and the color of their skin, then race would be looked at as more than just skin color because your skin color is just the result of your ancestors having a certain amount of sun exposure over many generations.

Language Post

PART ONE NON-VERBAL 15 MINUTES

This experience of having a conversation with my girlfriend was a little bit difficult. I would like to think of our relationship as having good communication between one another. We had our first fifteen minute conversation where I did not use the spoken language. This part of the assignment was not that difficult for me or my girlfriend. We just had to alter the way we usually communicate. My girlfriend just changed the way she talked to me, and was asking yes or no questions in which I could reply with a yes or no head nod. During the first part I would say my girlfriend was in control of the conversation because she was the one who was asking the questions, it would be hard for me to ask questions without the use of the spoken language. The power was definitely in the hands of my girlfriend during this first part because she was in control of what we talked about and I had no say in the conversation if you get what I’m saying.  If this first part of the conversation was looked at as being two cultures I would think that the culture with the spoken language would have the advantage by controlling the conversation and directing in which way they like.  With communicating complex ideas with their respected communities the spoken language would have an easier time of getting the idea out to the people in a way they could understand. Present day cultures that can’t speak would possibly be primates. I would think that maybe since they can’t speak and we can, we treat them like animals and treat them differently. After taking this class I see that humans and primates are really not that different but yet the spoken language culture rains power over the culture that cannot speak, that’s just my opinion.

PART 2 NO BODY LANGUAGE

The second part of the assignment my girlfriend and I had a conversation in which I could speak, but use no other way of communication. I found this part a little more difficult because she could hear what I am saying but without any other form of communication it could be taken the wrong way. Technically my girlfriend could hear what I’m saying but the thing was did she understand the emotion behind it. I could say “I love you” but a statement like that is a very emotionally driven statement and without any feeling behind it, she almost felt like if I didn't mean it.  When we speak to someone and we can see their body language, we get the idea and emotion behind what they are saying. For example if someone is mad or sad and they speak to us, but are not allowed to yell or show any anger in their facial expression they really can’t get there point across. The ability to read body language could easily help a person survive, for example I am a police officer and on a daily basis I can do my job and protect myself by reading someone body language. This also helps in the animal world because you can tell if an animal is about to attack by their body language and this might give you the time to react or flee just like when I’m talking to a person at work, I can read body language and tell if they are being aggressive and are about to attack.  Body language also helps with reproduction success because while reading body language you can sometimes tell if a woman is interested in you, but that’s another story because even with reading body language woman are still hard to read. I think a situation to being able to not read someone’s body language would be anytime you’re trying to buy something that the seller gets a commission. Take car salesman for example you can read their body language and they appear to be nice and happy and pretend to be your friend but they are sending you unreliable information. They get something out of giving you false signals and there body language is not genuine. Some people with disabilities like being blind and autistic people have a hard time reading body language.

Piltdown Man

              The Piltdown Hoax is probably one of the greatest mysteries in the science community. It all started in 1912 in an English village called Piltdown. A scientist named Charles Dawson was digging in a gravel pit when he discovered a piece of an ancient human skull. Dawson invited his friend Arthur Woodward to help him in the dig. Woodward was England’s leading geologist.  Father Pierre Teilhard who trained as a paleontologist also wanted in on the dig.  The thing is that fossils of possibly early humans were found in France, Germany, and Asia but no remains were ever found in England. Dawson then discovered a jawbone in the gravel pit, it was almost like an ape jawbone but the teeth were worn flat like a humans. This find could be our early ancestor and is the missing puzzle piece between humans and primates.

                In December 1912 the Royal Geology Society in England had praised the find. Woodward was happy because it became evidence for his theory that big brains evolved first in primate compared to upright walking, even though today we know the truth is opposite the fact that upright walking came before brains.

                In 1916 Charles Dawson dies, and it’s strange that after his death there are no more fossils found at the dig in Piltdown. Thru 1920 there are many early fossils found of possible early humans, but the fossils found are more ape and not more human like the Piltdown skull. The thing is that the Piltdown is supposed to be older than the fossils found in Asia Africa and something wasn’t making sense. The problem was that the Natural History Museum was not letting any outsiders near the Piltdown man skull, so it could not be tested. It was kept under lock and key and heavily guarded.

                After World War II, there was new technology in the science community.  They discovered that by measuring the Fluorine content if the fossils that were found scientist could roughly determine and date the finds.  In 1949 this type of test was done on the Piltdown man and it was discovered that the Jaw was not even 100 years old, and it was from a female Orangutan. The teeth in the Jaw had been filed down to make flat with some type of tool. The Artifacts had even been stained to make them appear older than they were.

                This was a shock to the science community, but the thing was that scientists are supposed to be scholars and Gentleman and I think they are usually trusted, but this changed the society’s opinion. Sure they all had motives to do what they did, but till this day we still do not know who is responsible for the Hoax. I think that Dawson was a guidable man and didn’t have no idea what was going on. Then you have Woodward, the fid would of helped support his theories but then after Dawson died, Woodward still continued to dig at the site. If you were the one who made the fraudulent skull, then why would you continue to dig? Then there is Dawson’s assistant Martin Hinton, who didn’t really have a motive, but they did find a trunk belonging to Hinton with bones with the same stain as the Piltdown find.  So we still don’t know who the mastermind was behind probably the greatest fraud of all time, and until we have father testing we still may never know the whole truth.

                The life lesson we have learned from this is only this, great science depends on objectivity. Once a scientist’s national pride and self-interest comes into that objectivity is obscured. Scientist have become highly vulnerable as a result of this and are susceptible to lies, cheats, and deception. The only good thing that came from this Hoax, is that when something comes into science it will not be believed until there is evidence. We are just lucky that we have the technology today that can test a hypothesis in many different ways to determine the authenticity and weed out the fakes. The “Human” factor cannot be removed from science, because we indeed are all human who makes mistakes but as long as we learn from our mistakes we will be fine and succeed.

Mistakes make us stronger and smarter, as long as we learn from them instead of repeating them.

Primate Comparison On Locomotion

LEMURS:

ENVIORMENT:

Lemurs are only found in Madagascar which is an island off the coast in Africa. Some believe that the lemurs came upon the islands on rafts made of natural vegetation. The weather it nice as it is a tropical climate. Lemurs are endangered because the forest in which the live in along the coast is being torn down for cultivation and farmlands.

LOCOMOTION:

Lemurs usually move around using their arms and legs making them quadrupeds. They can push off from their hind legs and can leap from tree to tree. Lemurs also move around on the ground using all of their limbs to run, leap, and move in a hoping motion. The lemurs cannot use their tails as an extra limb, but they do indeed use their tails for balance.

EVIORMENTAL INFLUNCE ON LOCOMOTION:

Lemurs being mostly arboreal has changed or influenced their locomotion to make them excellent climbers. Lemur’s diet consist of fruit, leaves, flowers, and seeds which are mostly found up high in the trees. Troops which are a group of lemurs sleep in neighbor trees in between feedings. The lemurs rarely sleep in the same trees twice. We can see that because of the diet and being mostly arboreal, that the environment in which lemurs live has influenced the lemurs locomotion patterns. 

 http://library.sandiegozoo.org/factsheets/ringtailed_lemur/lemur.htm

SPIDER MONKEY

ENVIRONMENT:

Sider monkeys are diurnal and arboreal meaning that they are found mostly living high in the trees. They live in rainforests mostly in the upper canopy area. They are found in South America. The spider monkey lives high up in the top of the tree line as to minimize being disturbed by humans.

LOCOMOTION:

The spider monkey like to use a use a type of locomotion which is termed semi-brachiation which is more of a leaping with a little arm swinging thrown into the mix. They also use all four limbs making them quadrupedal. They can also use their tails for an extra support when feeding and moving through the trees.

ENVIRONMENTAL INFLUENCE ON LOCOMOTION:

Because they spend most of their time high up in the canopy of the rainforest it would make sense for them to be great tree climbers and swingers as they are. They also eat fruit, leaves, seeds, and aerial roots which are found high in the canopies. The environment has had an influence on the spider monkeys making them have strong semi-brachiation traits.

http://www.angrydmonkey.com/different-locomotion-in-spider-monkeys-study.html

BABOONS:

 

ENVIRONMENT:

Baboons are very good at adapting to various environments, because of this they are found in many different regions of Africa (Zambia, Kenya, Tanzania) just to name a few. They live mostly in the vast lands of the Sahara’s on the ground. They only use tree’s to sleep and escape predators.

LOCOMOTION:

Baboons move around quadrupedally using all four limbs. Their arms arm longer then their hind legs so they walk almost hunched over. Baboons differ from new world monkeys because they do not have tails.  Baboons do climb trees but mostly on the ground looking for food. As I stated earlier they use trees to sleep or escape predators.

ENVIRONMENTAL INFLUENCE ON LOCOMOTION:

Living in Africa walking the savannahs they really don’t need the expertise of climbing trees, but the can if need be. The baboon has adapted to its environment by being a efficient ground walker walking around the savannah.

http://a-z-animals.com/animals/baboon/

GIBBONS

ENVIRONMENT:

Gibbons are found in the lowlands in Vietnam. The climate is somewhat sub-tropical they have rain seasons that last for months at a time.

LOCOMOTION:

Gibbons spend most of their day in the forest canopy searching for food which consists of leaves, flowers, leaf buds and insects. Since they are arboreal they use a highly specialized of brachiation which is swinging one hand over the other to move from branch to branch. They are rarely seen moving quadrapedally , but when on the ground they move bi-pedaly.

ENVIRONMENTAL INFLUENCE ON LOCOMOTION:

Since they spend most of their time up swinging with their cup/hook like hands high in the canopy to avoid predators down on the ground. We can asee how the environment in which they live has influenced to use the locomotion they use.

http://pin.primate.wisc.edu/factsheets/entry/white-cheeked_gibbon

CHIMPANZEE

 

ENVIRONMENT:

They are natives to Africa in the rainforest, woodlands and grasslands. They are mostly found on the ground but can climb trees if need be. Chimpanzee’s do not have tails and live in social groups called a fission fusion society.

LOCOMOTION:

Chimpanzee’s walk on their knuckles “knuckle walking”. Their arms are much longer then their hind legs. Chimpanzee’s however can stand straight up and walk bi-pedaly as well. They also can swing from branch to branch using brachiaiton. Some think that because of their long arms chimps were more arboreal primates to start out, even though not they are found on the ground.

ENVIRONMENTAL INFLUENCE ON LOCOMOTION:

We can see that chimpanzee’s possibly started out as being arboreal because of the length of their arms but they have adapted to living on the ground. They eat leaves, fruits, and insects even using tools to catch their food like termite fishing. We can see how the environment has changed the locomotion of these primates than to maybe what they started out as.

http://animals.nationalgeographic.com/animals/mammals/chimpanzee/

CONCLUSION:

In conclusion with all five primates being quadrupeds and vertical climbers and arboreal, each has developed certain strengths depending on the environment in which they spend their lives. Each had adapted and improved its locomotion patterns depending on its environmental influence from its habitats down to its dietary needs.

Homology / Analogy Traits

                        vs                    

                                                                 

Human Vs. Cats

The two different species I have selected in the Homologous trait category is Humans and cats. Humans are homo sapiens while cats are felius catus. Humans are bipeds while cats are quadrupeds. One thing that is a homologous trait is that the bone structure of the Human and cat are very much similar.  The human’s forelimbs have  a Humerus, Radius, Ulna, Carpals, Metacarpals, and Phalanges, The cats forelimbs have the same identical bones even though at first glance they appear to be different to the naked eye. Even though the structures are comprised of the same bones, they are very much different in the way they function. Humans have elongated fingers and  hands that are used to grasp things. Humans are able to grasp things because of the opposable thumbs.  The hands and fingers are used to hold tools and throw objects. Humans also have forelimbs that bend at the elbow which is helpful when consuming nutrition and food. Cats on the other hand are Quadra pedal meaning they walk on all four limbs and they do not have opposable thumbs. The cats forelimbs  cats are digitigrades meaning they walk directly on their toes. When cats walk their back legs step directly behind their  front paws which  results in minimal noise helping them to sneak up on their prey. It also increases their speed when running after their pray and when jumping and pouncing.

After doing a lot of research it is said that the common ancestor of the human and the cat would have been a placental mammal  over 70 million years ago. In 1997 the fossils of this so called ancestral mammal’s fossils were discovered in the Gobi Desert and they called it Maelestes gobiensis. The mammal has the same bone structure so we know it had the same homologous trait, but the function of how this trait was used is still a mystery.

                           vs                     

                                               

Dolphins Vs. Sharks

For the analogous trait the two species I chose were Dolphins and Sharks.  A dolphin is a mammal that lives in the ocean. They can be from four feet all the way up to 30 feet. The dolphin’s body is adapted for fast swimming. They also communicate and navigate using sonar. Dolphins have very good eye sight in and out of the water. The dolphins body is comprised of a beak which it the mouth, a melon which is their head. A blowhole they use for getting air, a dorsal fin which is on the topside of their body, a tail fin which is called fluke used for swimming and flippers that they use for maneuvering through the water. Dolphins are carnivores.

Sharks are fish with approx. five to seven gill slits that they use to breathe underwater.  They have two pectoral fins that are fused to the head that they use to maneuver through the water. Sharks also have two sets of dorsal fins used for steering in the ocean. The shark has a tail fin as well but it is called a caudal fin. The last two fins a shark have an anal fin and a pelvic fin. Sharks eye sight is not a good as dolphins, and they lay eggs where the dolphin does not. Sharks are also carnivorous.

 The analogous traits these two have in common is they both have the same body shape for example the tail fin, the dorsal fin, and the flippers/pectoral fin which they use to swim through the water as they prey on fish. They are both fast swimmers.

If you go way back they common ancestor could have possessed these common traits. We know that these traits are analogous because Dolphins are Mammals and Sharks are fish. Even though sharks and dolphin have similar body shapes and possess similar traits they are not genetically related from common decent.

PROTEIN SYNTHESIS DNA BLOG

TTCTTACACACACGCAAGCTTGCACGGGAACGTCGTAGTGCCGTTAATCTAAC

Historical Influenes on Darwin

I have chosen Jean-Baptiste Lamark in having the most influence over Darwin's development of the theory of Natural Selection. Lamark's gave many great ideas and theories to the scientific community even though most of those theories have been discredited today. Lamarks thinking  was that all things started from simple organisms and that through generations they evolved towards more complex forms. He also believed that organisms evolved depending on their environments and surroundings. Over time if a organism did not use a certain body part or organ those would shrivel up and not be passed on to the offspring. His most notable theory was that giraffes started with shorter necks, but would stretch their necks for high tree leaves. The change in their behaviors passed on those improved structures. The bottom line was that Lamark believed that evolution was a constant process of organisms striving for perfection over many generations.

http://www.pbs.org/wgbh/evolution/library/02/3/l_023_01.html

The bullet point that was most influential by Lamark would be "If the environment changes, the traits that are helpful or adaptive to that environment will be different."  This point was influenced by Lamarks work because his thoughts and beliefs were that organisms evolved depending on its surroundings. This also created new species that could survive depending on the environment in which the organism lived in.

I think that Darwin still would have developed the theory of Natural selection without the influence of Lamark's ideas, but they did probably give him the push he needed. When Darwin set sail on his journey around the world his beliefs were set on the idea of Fixity, that God created man and we do not change and we are perfect. When Darwin discovered the Finches, and started to realize that depending on the environment the Finches were found in they appeared to have different traits making them different species. This gave Darwin the thought that organisms do evolve depending on their environments, which was the ideas of Lamark.

The Church had Darwin thinking of the idea Fixity, but after his journey Darwin had a different out look on things. Back then people mostly scientist were executed for trying to use science to prove a natural phenomena. Darwin was hesitant to publish his book because of the consequences he could face,  Not until Alfred Russel Wallace sent him an article and Darwin became aware he was going to publish about the Theory of  Evolution did he go and release the book Origins Species, and we thank him for that.